Table 2

Real-time PCR primer information.

Primer IDPrimer nameSequenceStartTmLocationProduct SizeSNP
376MAGE-A3-FGGCAGTGATCCTGCATGTTAT99659.98exon3154none
377MAGE-A3-RCTTCCCCCTCTGTCAAAACC114960.04exon3none
372PLAC1-FTGCTGTGCTCCATAGACTGG36960.01exon3125none
373PLAC1-RGTGTGGCTGAACATGGTTTG49360.01exon3none
380GAGE1-FGTTGGCGAGGAAGATCGAC12160.76exon2125none
381GAGE1-RTTCTTCAGGTGTTGCTGGTTC24560.28exon3none
382CTAG2-FCACCCAAACACAAGGTCTCA56259.57exon2115none
383CTAG2-RGGGGCAGAGAACATCACATT67659.93exon2none