Table 1

Semi-quantitative RT-PCR primer information.

Gene SymbolGene nameRef SeqAmplicon size (bp)Primers (Forward and Reverse) (5′–3′)
MAGE-A1melanoma antigen family A, 1NM_004988421CGGCCGAAGGAACCTGACCCAG
GCTGGAACCCTCACTGGGTIGCC
MAGE-A3melanoma antigen family A, 3NM_005362422GAAGCCGGCCCAGGCTCG
GGAGTCCTCATAGGATTGGCT
MAGE-A4melanoma antigen family A, 4NM_001011550
NM_001011549
NM_002362
401CCAGGCCCTGTGAGGAGT
CAGCAAGTGAAGCTGATGGT
MAGE-A10melanoma antigen family A, 10NM_001011543
NM_021048
501
410
GGAACCCCTCTTTTGTAGAGAC
TCCTCTGGGGTGCTTGGTATTA
GAGE1
GAGE2
GAGE8
G antigen 1
G antigen 2
G antigen 8
NM_001468
NM_001472
NM_012196
243
243
243
GACCAAGACGCTACGTAG
CCATCAGGACCATCTTCA
CTAG1A
CTAG1B
cancer/testis antigen 1A
cancer/testis antigen 1B
NM_139250
NM_001327
332
332
CAGGGCTGAATGGATGCTGCAGA
GCGCCTCTGCCCTGAGGGAGG
CTAG2cancer/testis antigen 2NM_020994
NM_172377
503
274
CTTCTGCGCAGGATGGAAG
ATCAACAGGGAAAGCTGCTG
MAGE-C1melanoma antigen family C, 1NM_005462631GACGAGGATCGTCTCAGGTCAGC
ACATCCTCACCCTCAGGAGGG
MAGE-C2melanoma antigen family C, 2NM_016249355GGGAATCTGACGGATCGGA
GGAATGGAACGCCTGGAAC
PLAC1placenta-specific 1NM_021796327CCCCTCTTCAGTTCCAGTGA
CCAGTCTATGGAGCACAGCA