Article Figures & Data
Figures
- Figure 1
NW-BR-3 cDNA sequence and predicted amino acid sequence. The translation initiation codon and the termination codon are underlined. The RT-PCR analysis was carried out with the primers AGCGGTTTGGCACCGTACAGC and AGCTGTGTCGCCTGCCTTTGTGC. The probe for Northern blotting and nucleotide screening was generated with the primers GAAAAGGAGGCAAGGAGACAGC and TGATGCTCACGGAACTACGGTG.
- Figure 2
Alignment of the NW-BR-3 and mouse testis m-BR-3 predicted protein sequences. There is 70.5% amino acid homology between the two predicted polypeptides. The amino terminus of the human NY-BR-3 sequence is longer.
- Figure 3
Northern Blot analysis of NW-BR-3 mRNA expression. (a) The NW-BR-3 probe hybridizes to a single mRNA species of approx. 1.9 kb. All other normal tissues do not yield a detectable signal. (b) Control hybridizations using an actin probe.
- Figure 4
Analysis of NW-BR-3 mRNA expression by RT-PCR. In normal tissues, a strong signal is observed in testis, weak signals in brain, kidney, trachea, uterus, and prostate (a); all other tissues tested are negative. (b) and (c) NW-BR-3 expression in several tumors and tumor cell lines. ZR-75-1, MCF 7, SK-BR-3, and Cama are breast cancer cell lines; CRL 10995 is a prostate cancer cell line; Asc-1, SK OV-3, and NW0192 - NW0049 are ovarian cancer cell lines. Abbreviations: BC, breast cancer; MEL, melanoma; OC, ovarian cancer; PC, prostate cancer; RC, renal cancer; TCC, transitional cell cancer.
Tables
- Table 1
Antigens identified by SEREX.
Designation No. of Clones GenBank UniGene Expression NW-BR-1 3 NY-BR-1 Hs.326736 breast, testis, breast cancer NW-BR-2 1 SCP-1 Hs.112743 `cancer/testis NW-BR-3 9 clone 18CGI1F2 Hs.339651 `cancer/testis-like NW-BR-4 1 KIAA1005 Hs.12328 ubiquitous NW-BR-5 1 KIAA0635 Hs.185091 ubiquitous NW-BR-6 2 LZ16 Hs.42390 ubiquitous NW-BR-7 1 PRDM5 Hs.192867 ubiquitous NW-BR-8 1 CTC-260F20 Hs.279574 ubiquitous NW-BR-9 1 TFNR Hs.272808 ubiquitous NW-BR-10 1 ROCK1 Hs.17820 ubiquitous NW-BR-11 1 MARKL1 Hs.118843 ubiquitous NW-BR-12 1 GCP3 Hs.9884 ubiquitous NW-BR-13 1 unknown Hs.125201 ubiquitous
Volume 2, Issue 1
