Table 1

Genes, PCR primers and products.

Gene PCR Primer Sequences PCR Product
Name GI No. Size (bp) Nucleotides Spanned
IL-10 6754317 5':  CGGGAAGACAATAACTG 186 148-333
3':  CATTTCCGATAAGGCTTGG
IFN-gamma 28501526 5':  AACGCTACACACTGCATCTTG 237 112-348
3':  GACTTCAAAGAGTCTGAGG
TNF-alpha 7305584 5':  AGTGGTGCCAGCCGATGGGTTGT 253 537-789
3':  GCTGAGTTGGTCCCCCTTCTCCAG
Bax 17390521 5':  CCAAGAAGCTGAGCGAGTGTCTC 146 235-381
3': AGTTGCCATCAGCAAACATGTCA
Bcl2 6753167 5': CAGCTGCACCTGACG 303 343-641
3': AGAGACAGCCAGGAG
Bcl7C 13542972 5': GGCGACCATCGAGAAGGTCCG 318 305-622
3': GTTGGTGATCCAGGGCGGC
cdc25C 13435584 5': CACCAGTTTAAAGGCATTGG 230 519-748
3': GACTTAAGCCCTTGGCGTCC
IL-10R1 6680388 5': CTGAGCCTAGAATTCATTGCATAC 388 122-509
3': CATAGATGATGCCGTCCATTGCTT
IL-10R2 17646387 5': CCACCCCCTGAGAAGGTC 599 80-678
3': CAGGAAGGGGTTATTTCG
p27 17939614 5': GGCTCTGCTCCATTTGACTG 393 342-734
3': CCTGCCATTCGTATCTGCCC
IL-19 28482156 5': CCGGATCCCTCAGTTCATATCTACAGTCTTAG 477 166-643
3': TTGAATTCAGGCTGCAGGAGTTTCCAGATG
IL-22 8393604 5': AAATGCGCTGCCCGTCAACAC 192 146-337
3': ACCTGCTTCATCAGGTAGCAC
IFN-lambda 27261790 5': GCGGTACCATGACTGGGGACTGCACGCCAGTG 595 9-603
3': CGGAATTCAGGTGGACTCAGGGTGGGTTGA
HPRT 13435620 5': GTTGGATACAGGCCAGACTTTGTTG 162 575-737
3': GATTCAACTTGCGCTCATCTTAGGC